Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST56315
Clone ID OST56315
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST56315
Sequence
CTATATGGTTGTGGACTCCTNAATCATGANCCTGGANAAAAANCCAGACTTCAGCTGCCTACCATGAAGGAGAATGACAC
CCACTGCATTGATTTCAGTTACCTGTTATATAGCCAGAAGGGGTTGAACCCTGGCACTTTGAATATCCTAGTTAGGGTGA
ATAAAGGACCTCTTGCTAATCCAATAA
Sequence Type mRNA
Unitrap ID UNI10135

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 27983311..27983496 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019889 (Ptprk) NM_008983 protein tyrosine phosphatase, receptor type, K Gene [Source:MGI Symbol;Acc:MGI:103310]

 
Come back to gene ENSMUSG00000019889


For any suggestions or comments, please send an email to unitrap@crg.es