Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0253
Clone ID GC0253
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0253
Sequence
TGGGATGAACTCCTGGAGGTCTTTCGCCTCACAGTCCTTGAGCATGTGCTCCGAGGCCGACGGGATGAACGGGAGCACCT
CCTCCTCGAGGCAGATGATCAT
Sequence Type mRNA
Unitrap ID UNI14

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 121040115..121040216 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034667 (Xpot) NP_001074525 exportin, tRNA (nuclear export receptor for tRNAs) Gene [Source:MGI Symbol;Acc:MGI:1920442]

 
Come back to gene ENSMUSG00000034667


For any suggestions or comments, please send an email to unitrap@crg.es