Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0035
Clone ID GC0035
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0035
Sequence
TTTGCCTTTGGTTGGTTTCTTGTTTGGAGTATCAGTTGAAACAGTTAATTCAATATTATCTGGATCGCCTCCTTCCTCTT
CAATAGCCTGCTTCAGCCGGGAGACCAGTACCGTCTTGACCCCGTTGATGTCCAAGTTGCGGCGCTTCAGCTCGGACCTG
AGGTCGATAACCCGCAGCTCGGTGATCTTCTTCCCTTCCGCCGGCCCAGAGGCGGCCGAGGCTACCACGGCCCCGGCAGC
GGCAGCC
Sequence Type mRNA
Unitrap ID UNI107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70390729..70391863 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032212 (Sltm) NM_025690 SAFB-like, transcription modulator Gene [Source:MGI Symbol;Acc:MGI:1913910]

 
Come back to gene ENSMUSG00000032212


For any suggestions or comments, please send an email to unitrap@crg.es