Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST55980
Clone ID OST55980
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST55980
Sequence
CACTGAGTACAGCGCTTTGGATACCAACCCACTCTCTCTGTATATCATGCATCCATTTTGGAACACTATAGTGAAGGTGT
TTCCTACTTGGCTGGCTCCCAATCTTATAACCTTTTCTGGCTTTATGCTGCTTGTGTTCAATTTCCTACTCCTGACATAC
TTCGACCCTGACTTCTATGCTTCAGCCCCTGGTCATAAGCATGTGCCTGACTGGGTTTGGATTGTCGTGGGCATCCTCAA
CTTTGCTGCCTACACTCTAGATGGAGTGGATGGAAAGCAAGCACGGAGAACCAATTCCAGCACCCCGTTAGGGGGAGCTG
TTTGACCATGGCCTGGACAGTTGGTCGTGTGTTTACTTTGTTGGGACTGGGTACTCCATCTTTGGCTTTTGG
Sequence Type mRNA
Unitrap ID UNI27590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30574007..30582747 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075703 (D5Wsu178e) NP_081928 Ethanolaminephosphotransferase 1 (EC 2.7.8.1)(Selenoprotein I)(SelI) [Source:UniProtKB/Swiss-Prot;Acc:Q80TA1]

 
Come back to gene ENSMUSG00000075703


For any suggestions or comments, please send an email to unitrap@crg.es