Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone TEA124
Clone ID TEA124
Vector pGT1Lxf
Project baygenomics

Sequence tag TEA124
Sequence
GCAAGAGAAAATGGAGCCGGCCAAGATGGCGCCTATCAAGAACGCTCCGAGAGATGCCTTGGTGATGGCACAGATCCTGA
AGGATATGGGAATCACAGAGTATGAGCCAAGGGTTATAAATCAAATGTTGGAATTTGCTTTCCGATATGTGACTACAATT
CTGGACGATGCAAAGATTTATTCGAGTCATGCTAAGAAACCCACTGTTGATGCCGATGACGTGAGACTGGCCATCCAGTG
TCGGGCTGACCAGTCCTTTACCTCTCCTCCCCCAAGAGATTTTTTACTAGATATTGCAAGGCAGAAGAATCAAACCCCTT
TGCCGCTGATTAAGCCATATGCAGGACCCAGACTGCCACCTGATAGATACTGCTTAACAGCTCCAAACTATAGGCTGAAG
TCCTTAGTTAAAAAGGGACCTAACCAAGGAAGACTAGTGCCTAGATTAAGTGCGGTCAGTAGTAGACCAACTACTCCTCC
TGTAGCACCCCCACAAGCAGTATCTGGCCCAAATAAGGCTGCAACTCCGGTGTCAGTGACAAGCCAAAGATTTGCTGTGC
AGATTCCACCTTCTCAGTCCACACCTGCCAAG
Sequence Type mRNA
Unitrap ID UNI8815

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103405050..103414978 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047242 (Taf9b) NM_001001176 TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI (curated);Acc:Taf9b-002]

 
Come back to gene ENSMUSG00000047242


For any suggestions or comments, please send an email to unitrap@crg.es