Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone TEA146
Clone ID TEA146
Vector pGT1Lxf
Project baygenomics

Sequence tag TEA146
Sequence
GGCGCTGCCGGTGGCTGGTTGCTGTCCAAAGGCGACTGGGCGTCGTTAGAGGAGAGAGCTGTGACCGGTTGTACTGCACG
TATCGTGGGACGGACCTTGGGCCACTGTTGTCGACGTGCGGCCTCCCTTTGATGTCGGCCCTTGAAAAAAGCATGCACCT
CGGCCGCCTACCTTCTCGCCCTCCTCTACCCGGCAGCGGGGGCAGTCAGAGCGGAGCCAAGATGCGGATGGGCCCTGGAC
GGAAGCGGGACTTTACCCCTGTCCCATGGAGTCAGTACTTTGAGTCAATGGAAGATGTGGAAGTGGAGAATGAAACTGGC
AAGGAAGATGTGGAAGTGGAGAATGAAACT
Sequence Type mRNA
Unitrap ID UNI8818

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107503779..107520464 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030718 (Ppme1) NM_028292 protein phosphatase methylesterase 1 Gene [Source:MGI Symbol;Acc:MGI:1919840]

 
Come back to gene ENSMUSG00000030718


For any suggestions or comments, please send an email to unitrap@crg.es