Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST55750
Clone ID OST55750
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST55750
Sequence
GACTGAGAAATAAATGGCTCCTGGGCAGAATCGAGTGGTTGCTCTTGTAGACATGGACTGCTTTTTTGTACAAGTGGAAC
AAGCGGCAAAATCCTCATTTGAGGAATAAACCTTGTGCAGTTGTACAGTACAAATCATGGAAAGGTGGTGGAATTATTGC
AGTTAGCTATGAAGCCCGAGCATTTGGAGTCACTAGAAACATGTGGGCGGATGACGCTAAGAAGTTATGTCCAGATCTTC
TCCTGGCACAAGTTCGTGAGTCCCGTGGAAAAGCTAACCTCACCAAGTAAGCAAAAGCATTGTAAATGAACATAGAGGAG
TCAGAAAGTGTTTCCTGGGATGGAGTGTGGCTCCGGANGGAAAANGNNTNCCNTAACTTCCGNNACCTCNTGGGGTTTAT
TACCCANGGAACACACTTTNAAAACTTTNACAGGGGATACTTGNTACTGGTANGCCTGCTGCTCCTTGNTTCNATAAACC
TGCTTGTTTAATCCTA
Sequence Type mRNA
Unitrap ID UNI27257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46335386..46336485 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023953 (Polh) NM_030715 polymerase (DNA directed), eta (RAD 30 related) Gene [Source:MGI Symbol;Acc:MGI:1891457]

 
Come back to gene ENSMUSG00000023953


For any suggestions or comments, please send an email to unitrap@crg.es