Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST55342
Clone ID OST55342
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST55342
Sequence
TCGAGGGAGATGAGAACTCACCTACCATCTGAAAGTCTTAAGGTTTGCTGACAGACAAAACCGGGCTTTGAATGGAGCGT
GAACTCCTGAGGCGAGCATTGGCCCGAGAGAGCCGAGGATGCAGGTGTTGGTCTGATCTTGATTTCAGGTACTTTTGGAA
TACAGAATACCAGATGTGTTCCTGCTGCCCAGCCCCACAAGGCTATGCAGAATGCAAAGAAGAGTTACTTTTTGGCTGGG
GAGTAGTGGTATCATGTGCACTATTGCTGGAAATAATAAATATTGGCCTATCTGTAGAAATAAAAATCTGACTAATGATA
A
Sequence Type mRNA
Unitrap ID UNI3406

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166889186..166891358 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074578 (1500012F01Rik) NM_001081005 RIKEN cDNA 1500012F01 gene Gene [Source:MGI Symbol;Acc:MGI:1916199]

 
Come back to gene ENSMUSG00000074578


For any suggestions or comments, please send an email to unitrap@crg.es