Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST55254
Clone ID OST55254
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST55254
Sequence
AGAAAGGGAAAGTCAAGGATGCTGGAGCAGAACAATGGATTNCTCTTTCTCTTTCATGCAAGGGATCATGGGAAACACAA
TTCAGCAACCACCTNAACTCATTGACTCGGCCAACATCCGCCAGGAGGATGCCTTTGATAACCACAGTGACATTGTTGAA
GATGGNGGCCCGACACCCTTTGAAGCTACTTTGCAACAAGGTTTTCAATATCCACCTACAACAGAAGACCTTCCTCCGCT
Sequence Type mRNA
Unitrap ID UNI27610

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26751059..26751298 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054823 (Whsc1l1) NM_001001735 Wolf-Hirschhorn syndrome candidate 1-like 1 (human) Gene [Source:MGI Symbol;Acc:MGI:2142581]

 
Come back to gene ENSMUSG00000054823


For any suggestions or comments, please send an email to unitrap@crg.es