Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST55228
Clone ID OST55228
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST55228
Sequence
GAGAAGGCTCTGGTGCTGACTGCAGACGCCATGTCCAAAAGCTAAATCTGCTGCAAGGACAAGTGTCAGAGCTGTCACTC
AGGTCTGNGGAGGAAGCTGNAAATGGCAGTGAANAAGAAAATGCAGGCCCTCTGCAGGCCGNGGCTGGGAGTCAGCANGC
ACCGNNTAANCCCCTCNAGTCCCGTTGGTTGAAGNATCTGNACAAGGGCTGCGAGGACCAGGAGCTGGACAGAGGGAGAC
CANCTNTTAANACACAGCTTTCAACCAGTGCTGAGCGGCCAAGCAGTCCAGCCCAACCCAGGAAGAGGAAATGGAATCAG
CGCACAGGGCAGCCTGCACACAGCCTGCATGGCCCGGGTGGGGACAG
Sequence Type mRNA
Unitrap ID UNI27611

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 49996003..50011180 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020381 (3010026O09Rik) NP_080819 RIKEN cDNA 3010026O09 gene Gene [Source:MGI Symbol;Acc:MGI:1915317]

 
Come back to gene ENSMUSG00000020381


For any suggestions or comments, please send an email to unitrap@crg.es