Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone TEA130
Clone ID TEA130
Vector pGT1Lxf
Project baygenomics

Sequence tag TEA130
Sequence
CGGCGGCTGTGGACGCAGTCCCCGAGCTCGGGCTTTGGACGAGGACGGTCAATGACAAATCAGGACCTTTGGTATTCAGG
AAAACTATGTTTAACTCTACTGAGATCAAGTTTTCTGTGAAGTCGTTCAGTTGTTCTGGACCTGTGAAGTTTACCATAGA
GTGGCATTTGAAGTATCATACCTGTCACAATGATTACCCTGATCTGGAGGAGGAGCTGTCCCAAAGACATGAACTTCATG
CTGATCCAGATGTCTGTGCTTACTTCAAAAACATTGACTGTTGGACAACAAAAAGTGAAAACTTGGATTGCAGCAGTGAT
TCACAGGCATTTCCCTCATTGAATAATAAAGAACTAACAGGTATCAGAAACATTTCAAGCCAGGAAGGATCAACGGATGT
TGTAGCCAGGACCCAGAAAGATGGCTTCCATATCTTCATTGTTTCTATTAAAACGGAGAAAACAGATGCAGTCTGGGATT
TAAATGTTTCTCTTTCTATGGTGGGTCCTCATGGGTACATCTCTGCATCAGACTGGCCTCTCATGATT
Sequence Type mRNA
Unitrap ID UNI8825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128644184..128656995 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014353 (Tmem87b) NM_028248 transmembrane protein 87B Gene [Source:MGI (curated);Acc:Tmem87b-001]

 
Come back to gene ENSMUSG00000014353


For any suggestions or comments, please send an email to unitrap@crg.es