Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone TEA205
Clone ID TEA205
Vector pGT1Lxf
Project baygenomics

Sequence tag TEA205
Sequence
ATCTGCCATTTTCTCTACCTGAGTGAGTCTCTGCTGTCCGGAATTCTCTGGTTTTCTTCGCAGGCAGTGTTGTGCCCACT
GGCCCACCACCTCAGGGGAACGATGGCCACAGAGTCTACAGCCGCTGCTGCCATCGCCGCGGAGCTGGTTTCCGCTGACA
GAATTGAAGATGCTCCTGCTCCTTGTACCTCGGCAGATAAAATGGAGAGTCTGGATGTGGATAGTGAAGCTAAGAATCTA
CTGGGATTAGGACAGAAACATCTGGTGATGGGTGACATTCCAGCAGCTGTTAATGCATTCCAGGAAGCAGCTAGTTTTTT
AGGTAAGAAGTATGGAGGGCTGGTTAATGAGTGTGGAGAAGCCTTCTTTTTTTATGGGAAGTCACTTCTGGAGTTAGCCA
GAATGCAGAATGGAGTGTTGGGAAATGCCTTAGAAGGACGTGCATGTAGAAGAGGAAGAAGGAGAAAATGCAGAAGCATG
AATCTTTGGTAGAACATAATGATAATGTAGAT
Sequence Type mRNA
Unitrap ID UNI1664

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116284578..116300097 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es