Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST55059
Clone ID OST55059
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST55059
Sequence
CTTGAGTCTTGAATCCAGACAATAGTTTTGAAATATTAGTTGACCAGTCTGTTGTGAACAAGTGGAAATCTGCTAAATGA
CATGACTCCTCCTGTAAACCCTTCACGTGAAATTGAAGACCCAGAAGACCGGAAGCCTGAAGATTGGGATGAAAGGCCCA
AAATAGCAGATCCAGATGCTGTCAAGCCAGATGACTGGGATGAANACGCCCCTTCTAAGATCCCAGATGAAGAGGCCACC
AAGCCTGAAGGCTGGCTAGACGACNAACCTGAGTATATTCCA
Sequence Type mRNA
Unitrap ID UNI6967

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50115289..50118022 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020368 (Canx) NM_007597 calnexin Gene [Source:MGI (curated);Acc:Canx-001]

 
Come back to gene ENSMUSG00000020368


For any suggestions or comments, please send an email to unitrap@crg.es