Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone TEA218
Clone ID TEA218
Vector pGT1Lxf
Project baygenomics

Sequence tag TEA218
Sequence
CAAGAACTGATCAGTGGTTTTCACCTTATGGAAGAACTCTAGAAGCATAAATATGGTGCCGAAACTCCTCATTCTGTGAC
TGTGGTGATTTGGACATACTTCTGTGTGGAGGAGAAATATACACGCTGAGGTCACTCATTGTTCAGAGACTGTCGTGTAG
GAACATGGACCATTGTAATAGGGAAAAGGATGATAGACAACGGACAACTAAAACCATGGCACAAAGGAATACACACTGTT
CGAGACCATCTGGCACTTCAACATCCTCTGGGGTTCTCATGGTGGGACCCAACTTCAGGGTTGGCAAGAAGATAGGGTGT
GGGAACTTCGGAGAGCTCAGATTAGGTAAAAATCTCTACACCAATGAATATGTAGCCATTAAACTGGAACCAATAAAATC
ACGTGCTCCATCAACTTCATTTAGAGTACAGGTTTTATAAACAGCTTGGCAGTG
Sequence Type mRNA
Unitrap ID UNI8828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65806184..65828776 337
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032384 (Csnk1g1) NM_173185 casein kinase 1, gamma 1 Gene [Source:MGI (curated);Acc:Csnk1g1-001]

 
Come back to gene ENSMUSG00000032384


For any suggestions or comments, please send an email to unitrap@crg.es