Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST54955
Clone ID OST54955
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST54955
Sequence
AGAACTGAGTCAGCATCGGAATCTCAATGGTACTGGAGATATGAGGAGGGCACCAGTCCAGTCATCAAGATCATCTCCGG
AAGGATCCATATGCTAATCTAATGTTGCAGCGGGAGAAGGATTGGGTCTCTAAAATACAGATGATGCAGCTGCAGAGCAC
AAA
Sequence Type mRNA
Unitrap ID UNI27631

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 12004363..12004514 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046139 (Patl1) NM_172635 protein associated with topoisomerase II homolog 1 (yeast) Gene [Source:MGI Symbol;Acc:MGI:2147679]

 
Come back to gene ENSMUSG00000046139


For any suggestions or comments, please send an email to unitrap@crg.es