Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST54942
Clone ID OST54942
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST54942
Sequence
CAACTGAGGTCGCCATGGATCGGATGAAGAAGATCAAACGGCAGCTGTCAATGACACTCCGAGGGGGCCGAGGCATAGAT
AAGACCAATGGTGTCCCTGAGCAGNCAGNNNNNGNNGNGATGCCACACCCCTTACAGGGCAACCCNCATCTGCAATCCTC
CCTGCTTGNTGCCTGCTTACCTGCCTGANCCACACTCCCCTGCCAACTTGTCCCCTGCCACCTGCCCAAACACCAAANCA
NTGGCCTGGNCTGTCAACCCAACCATTGGCCTGTCTGCTGGGTGCTAACAAAGCTCTCACCACTAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20270448..20276012 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031065 (Pctk1) NM_011049 PCTAIRE-motif protein kinase 1 Gene [Source:MGI (curated);Acc:Pctk1-002]

 
Come back to gene ENSMUSG00000031065


For any suggestions or comments, please send an email to unitrap@crg.es