Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST54882
Clone ID OST54882
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST54882
Sequence
ATGTGCTGCATTTCAAAGCTCAGGGACACGGTGCCAAAGGAGACAATGTCTATGAATTTCACCTGGAGTTCTTAGACCTT
GTGAAGCCAGAGCCGGTGTACAGGCTGACCCAGAGGCAGGTGAACATCACAGTCCAGAAGAAGGGGAGTCATTGGTGGGA
AAGACTCACCAAGCAAGAGAAGCGCCCATTGTTTTTGGCCCCTGACTTTGATCGCTGGCTGGATGAATCTGATGCGGAAA
TGGAGCTGAGAGCCAAGGAGGAAGAACGCCTAAATAAACTCAGACTANAAAGGGAAGGCTCCCCTGAAACTCTTACAAAC
TTGAAGAAAGGGTACCTGTTCATGTACAACCTTGTGCAGCTCCTGGGGNTCTTCTGGATCTTTGCAACCTCACAGTGCGG
Sequence Type mRNA
Unitrap ID UNI6338

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64848807..64858298 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033629 (Ptplad1) NM_021345 protein tyrosine phosphatase-like A domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1889341]

 
Come back to gene ENSMUSG00000033629


For any suggestions or comments, please send an email to unitrap@crg.es