Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST54805
Clone ID OST54805
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST54805
Sequence
GGAATAATACACCATGGTTTTGGATGACCTTCCAAACTTTGAAGACATCTATACTTCCTTGTGTTCATCTACAATGGGCG
ACTCAGAGGTGGAGTTTGACTCTGGACTAGAAGATGATGACACNAAAAGTGATAGTATTTTGGAGGATTCCACAATTTTT
GTAGCCTTCAAAGGAAATATAGATGATAAAGACTTCAAATGGAAACTGGATGCAATATTAAAGAATGTGCCCAACTTGTT
ACAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27644

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155263601..155263843 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038369 (Ncoa6) NM_019825 nuclear receptor coactivator 6 Gene [Source:MGI (curated);Acc:Ncoa6-001]

 
Come back to gene ENSMUSG00000038369


For any suggestions or comments, please send an email to unitrap@crg.es