Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST54787
Clone ID OST54787
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST54787
Sequence
GGGAAGCTGCTAAGAAGCAGGCCATGAAACACGACCAAATTGGAGATTCAGAAAGCTCTTGCAGAAGACTCCACTGTGTA
TGAGTATGACAGCGTTTATGATGAGATGCNGAAAAAGAAGGAAGAAAACAACCCCAAGCTGCTTCCGGGGAAGGATCGGA
AGCCCAAATATATTCACAACTTACTAAAAGCAGTCGAGATCAGGAAAAAGGAGCAGGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI1043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 76862919..76868477 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037958 (Ccdc55) NM_001012309 coiled-coil domain containing 55 Gene [Source:MGI (curated);Acc:Ccdc55-001]

 
Come back to gene ENSMUSG00000037958


For any suggestions or comments, please send an email to unitrap@crg.es