Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST54600
Clone ID OST54600
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST54600
Sequence
CTGTCTATGCTGTCACTGATCTGCTCCTGCTTCTACCCGGAGCCGCGCAACATCAACATCTACACCTACGACGACATGGA
GGTGAAGCAGATCAACAAGCGGGCCTCTGGCCAGGCTTTTGAGCTGATCTTGAAGCCACCATCTCCCATCTCAGAAGCTC
CACGAACTCTAGCTTCTCCAAAGAAGAAAGACCTGTCTCTGGAGGAGATTCAGAAAAAGCTGGAGGCTGCAGAGGAGCGA
AAAAAGTCTCAAGAGGCTCAAGTGCTTGAAGCAGTTGGCAGAGAAAAAGGAGCACCAACCGAAAGGTGCTCCANAAGGCG
CTGGAGGAAAACAACAACTTCAGCAAGATGGCGGAGGAGAAACTTGATCCTTGAGATGGACAGATTAAGGAAAACCGGGA
NGNTTATCTAACTGGTTTTCATTGACCGTCTGCAGGAAAA
Sequence Type mRNA
Unitrap ID UNI27652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8541864..8554982 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027500 (Stmn2) NM_025285 stathmin-like 2 Gene [Source:MGI Symbol;Acc:MGI:98241]

 
Come back to gene ENSMUSG00000027500


For any suggestions or comments, please send an email to unitrap@crg.es