Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST54309
Clone ID OST54309
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST54309
Sequence
AGGGGCTGGGTCATCCAGTTATCGCTTTGTCCAGAATGTGACCTCCGACCTTCAGCTGGCCGCAGAGTTTGCTGCGAAGG
CCGCCTCCGAGCAGCAAGCAGATGCGTCTGGCGGAGACAGCCCCAAGGTCTGACCTCAGACATGCTGTGGGGACCAAGAC
TCTAAAGCAAGGGTCCTGAGGGTGGCTCCGCTGGGGTATTCAAGGTTGCAGCACATGGCTGCATTGAAGGATCCGTCTAC
CTATGTCAGTTCCCAGACGTGAGCTTTGCCATTGCAGTGAGCTGGAGTCCTCTCCCCAACCCAGGACTTCTTGTTCTGTC
CACCGCTAGTGAGACATTTTCAGAGTTTAATAGTCTTTAAGACAAATGAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI10463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 142924671..142925039 369
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056493 (Foxk1) NM_199068 forkhead box K1 Gene [Source:MGI Symbol;Acc:MGI:1347488]

 
Come back to gene ENSMUSG00000056493


For any suggestions or comments, please send an email to unitrap@crg.es