Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XL817
Clone ID XL817
Vector pGT0Lxf
Project baygenomics

Sequence tag XL817
Sequence
TCTCTCGCGAGGACGGACGCCATTATCGCAGCTCCCCGACAAACACCACGAGAATTCCGCAGCCCACAC
Sequence Type mRNA
Unitrap ID UNI1163

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124474479..124474547 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025316 (Banp) NM_016812 BTG3 associated nuclear protein Gene [Source:MGI Symbol;Acc:MGI:1889023]

 
Come back to gene ENSMUSG00000025316


For any suggestions or comments, please send an email to unitrap@crg.es