Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST54205
Clone ID OST54205
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST54205
Sequence
GACTGAGGAATCTGATGCTTCTACCAGATGCATGGATGAAAATAACTATGACAGGGAAAGGTGTTCCAGTTACTTCTTGA
AGTACAAAAACTGCCGGCGATTCTGGAATTCTGTCATGATCCAAAGAAGACAAAATGGAGTTCAGCCATCTATGCCTACA
GCAGCAGAAAGAGACGAAATTTTGGGAGCAATGCAAAAGATGCCCTACTGAGTATTTGCATTAAAATTGTTTCTATAACT
TGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3869866..3870673 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042198 (Chchd7) NM_181391 coiled-coil-helix-coiled-coil-helix domain containing 7 Gene [Source:MGI (curated);Acc:Chchd7-010]

 
Come back to gene ENSMUSG00000042198


For any suggestions or comments, please send an email to unitrap@crg.es