Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XM060
Clone ID XM060
Vector pGT0Lxf
Project baygenomics

Sequence tag XM060
Sequence
AGCCCTTGTGCCCGGGCTGCCAGGGACAGAGGCCAACGCTCTGCAACACAAGATCAAGAACTCCATCTGCAAAACTGTAC
AATCTAAAGTGGACTGCATTTTGCAAGAAGTTGAGAAGTTTACAGACCTAGAGAAACTCTACCTCTACCTTCAACTGCCT
TCTGGTCTTAGCAGTGCAGAGAAAAGTGATCAGAATGCCATGTCATCTAGTCGGGCACAGCAAATGCATGCCTTTTCCTG
GATTCGAAATACCTTAGAGGAGCATCCTGAGACGTCACTCCCCAAACAGGAAGTCTATGATGAATACAAGAGCTACTGCG
ACAATCTTGGCTACCATCCATTAAGTGCTGCTGACTTTGGAAAAATCATGAAAAACGTCTTTCCAAACATGAAGGCACGC
CGTTTAGGCACTAGAGGCAAATCTAAATATTGCTACAGTGGACTAAGGAAAAAAGCTTTTGTTCATATGCCAACACTGCC
CAACCTTGACTTTCATAAAACTGGAGATGG
Sequence Type mRNA
Unitrap ID UNI8847

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72380719..72458194 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037674 (Rfx7) NM_001033536 regulatory factor X, 7 Gene [Source:MGI Symbol;Acc:MGI:2442675]

 
Come back to gene ENSMUSG00000037674


For any suggestions or comments, please send an email to unitrap@crg.es