Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST54050
Clone ID OST54050
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST54050
Sequence
GAGCCCTTTGACATATGATACTCTCCGGTTTGCTGAATTTGAAGATTTCCCTGAGACCTCAGAGCCTGTTTGGATTCTGG
GCAGAAAATACAGCATTTTCACAGAGAAGGACGAAAAAA
Sequence Type mRNA
Unitrap ID UNI10651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 95664628..95664731 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026280 (Atg4b) NM_174874 autophagy-related 4B (yeast) Gene [Source:MGI Symbol;Acc:MGI:1913865]

 
Come back to gene ENSMUSG00000026280


For any suggestions or comments, please send an email to unitrap@crg.es