Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST54020
Clone ID OST54020
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST54020
Sequence
AGAGACTGACAATTAAAAAGGATCTGAAGAAGTACTCCAAGATCTTTGAGCAGAAGGATCGCTTGAGCCAGTCCAAAGCT
TCAAAGGAACTGGTGGAAAGAAGGCGGACCATGATGGAGGACTTCCGGCAATACCGGAAAATGGCCCAGGAACTCTACAT
GAAGCAGAAGAACGAGCGTCTAGAGCTACGAGGAGGGGTGGACACTGACGAGCTGGACAGCAACGTGGATGACTGGGAGG
AAGAGACCATTGAGTTTTTTGTCACCGAGGAAGTCATTCCTCTGGGAAGTCAGGAGTGATCTCAGCACTGTGTGTCACCG
TGCCGTGCCCAGGATCCGAGGCCACCCTTCACGGCGAGCCTCGTGCTGGGCTCTTACCTGTGCTTTCTTGCTCTGGACTG
CGAGTGCACCCAGGGTTCTTCCATCCCGACACAAGCTCTGTGCCTTTANCCCCAGGTCCACAGGGGGGGACACTTNGAGC
CTTTTGCTCTCACCTTTGCCCTGGTTGGGGTTTTTAATTAACC
Sequence Type mRNA
Unitrap ID UNI27668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140918037..140919024 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056076 (Eif3b) NM_133916 eukaryotic translation initiation factor 3, subunit B Gene [Source:MGI Symbol;Acc:MGI:106478]

 
Come back to gene ENSMUSG00000056076


For any suggestions or comments, please send an email to unitrap@crg.es