Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST53965
Clone ID OST53965
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST53965
Sequence
TGTGATGAGAGATGAGTGTGGGGCGTCGAAGAGTCAAGTTGCTGGGCATCCTGATGATGGCAAATGTCTTCATTTATTTG
ATTGTGGAAGTCTCCAAAAACAGTAGCCAAGACAAAAATGGAAAGGGAGGAGTAATAATCCCGAAAGAGAAGTTCTGGAA
GCCACCCAGCACTCCCCGGGCATACTGGAACAGGGAACAGGAGAAGCTGAACAGGTGGTACAATCCCATCTTGAACAGGG
TGGCCAATCAGACAGGGGAGCTAGCCACATCTCCAAACACAAGTCACCTGAGCTATTGTGAACCAGACTCGACGGTCATG
ACAGCTGTGACAGNTNNTAATTNTCTGCCCGGACAGATTTAAAAGACTTTCTTTTT
Sequence Type mRNA
Unitrap ID UNI10281

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22425507..22737193 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051650 (B3gnt2) NM_016888 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 Gene [Source:MGI (curated);Acc:B3gnt2-002]

 
Come back to gene ENSMUSG00000051650


For any suggestions or comments, please send an email to unitrap@crg.es