Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XM179
Clone ID XM179
Vector pGT0Lxf
Project baygenomics

Sequence tag XM179
Sequence
GGGGGGGGGGTGGGCTCATCATCGATGTGTAGAGTGGTCACTGGGAATATGCCAAATGGAAGAACCATTATTAGTAAACG
TGGACAAAGCTGTTGTCTCAGGGAGCACAGAACGATGTGCATTTTGCAAACACCTTGGAGCCACTATCAAATGCTGTGAA
GAGAAGTGTACCCAGATGTACCATTACCCATGTGCTGCAGGGGCTGGCACCTTTCAGGACTTTAGTCACTTCTTCCTTCT
CTGTCCAGAACACATCGACCAAGCTCCTGAAAGATCAAAGGAAGATGCAAACTGTGCAGTGTGTGACAGCCCGGGAGATC
TTTTAGATCAGTTCTTTTGTACCACTTGTGGTCAGCACTACCATGGGATGTGCCTGGATATAGCTGTTACTCCACTAAAG
CGTGCTGGTTGGCAGTGTCCTGAGTGCAAAGTGTGCCAGAACTGCAAACAATCGGGAGAAGATAGCAAGATGCTGGTATG
TGATACATGTGACAAAGGGTACCATACTTTTTGTCTTCAACCTGTTATGAAAT
Sequence Type mRNA
Unitrap ID UNI8850

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 24891492..24910198 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038056 (Mll3) NM_001081383 myeloid/lymphoid or mixed-lineage leukemia 3 Gene [Source:MGI Symbol;Acc:MGI:2444959]

 
Come back to gene ENSMUSG00000038056


For any suggestions or comments, please send an email to unitrap@crg.es