Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST53744
Clone ID OST53744
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST53744
Sequence
GACTGAGAATGTTGAAGAATGTTTGTTCCAAGATCTTTGAAAATCAAGAGGAGTTCTAATGATGACCTCAAAAGCGGTGA
AGCTAAAAAAAGCAAGCCAGAAGCAGGAGGCCTTCAGGTGGAGGGAGACAGAGATACTCCGGTCCACACATCAGTCACTG
AGGAAGCTGTCACAGCAGACAAGCCCGGCCATGCATCAAGCACCAACAGTCCTTCTTGCCAGTTGGCTGAGGTTTCTTCC
ACAGGACCTGATGAGGGTGTGAAGGACAGCCACCCATCTGAAGAGCCTGTAAAGTCGTTTTCTAAAACCCAGCGGTGGCC
AGAGCCTGGGGAGCCTGTATGTGTCGTCTGCGGTCGTTATGGAGAGTATATCTGTGACAAGACGGACGAAAACCTGTGTA
GCTTGGAGNGCAAANCGAAACATNTGGTTCCAAGTTAAGGAA
Sequence Type mRNA
Unitrap ID UNI18641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138313157..138313592 417
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026404 (Ddx59) NM_026500 DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 Gene [Source:MGI (curated);Acc:Ddx59-001]

 
Come back to gene ENSMUSG00000026404


For any suggestions or comments, please send an email to unitrap@crg.es