Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST53151
Clone ID OST53151
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST53151
Sequence
TGAGGAGCCTGTGACCTTTGAGGATGTGGCTGTGAACTTCAGTCCAGGAGAGTGGGCTCTGTTGGATTCCAGTCAAAAGA
AGCTCTACAGAGATGTGATGACAGAAACCTTTATGAACCTGATCTCCATAGGGAAAACAGAAGAAAACATTGAAGAGGAC
TATGCTAATGTCAGAAGTCTGAGAACTCAGATGATTGGGAGAAATTGTAAATATGAAGATAGCTTTCAGCGTGGAGAAGC
CCACCACCGAATTCCANAATATGTTGTTAACAAAGGGCATGCCTTCTTGCAACAGCA
Sequence Type mRNA
Unitrap ID UNI27693

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33156803..33158779 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067430 (1700065O13Rik) NM_028543 RIKEN cDNA 1700065O13 gene Gene [Source:MGI Symbol;Acc:MGI:1920701]

 
Come back to gene ENSMUSG00000067430


For any suggestions or comments, please send an email to unitrap@crg.es