Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST53114
Clone ID OST53114
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST53114
Sequence
CTGAGTGATATGCAGCTTTCGAGGATCTGTCCCTCAAGGCCTGGTCTTAGAAATAGGAGAAACAGTTCAGATTCTTGAAA
AATGTGAAGGTTGGTACAGAGGAGTTTCAACAAAGAAGCCTAATGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTCTTTGTGNCTTTNTTNACTTGCAATACTACAGGTTTTACTTTTCTCTCAAGAATGCT
TATATGAGAATAGTTTCTACNTTTATTTTGAGAATTTTGATTAAATTGTGCCAAAGTTAGAAATTGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27694

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107060005..107081497 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039716 (Dock3) NM_153413 dedicator of cyto-kinesis 3 Gene [Source:MGI Symbol;Acc:MGI:2429763]

 
Come back to gene ENSMUSG00000039716


For any suggestions or comments, please send an email to unitrap@crg.es