Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST52685
Clone ID OST52685
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST52685
Sequence
TTTGGAGTGGATAATCATTCAGCTTTCCGTCCATCTTTATTTATGGACACACTGCCAGTGGGAANACCTATGTTACACAA
ACATTGTTGAAAACTTTAGAGCTCCGAGGATGCNTATTTAAGATGGCCTGCTGAGTTGCTCTGAAAACTTGCATTTGAAA
ACTTGTCTATNAAGTATCCTGGAGATAATTGTTGAATAANNGCATGAAAATCCAGTANAGGAGTTTTATGTTTAAGGAAT
GTATTATATTTTTAATACTTTATTACTTTTTGCAATCCCTTAATGTAAGAANAGATTTGTTTCTGTTATAGATGCCCAAA
TACATGCTTANAAAAAAATACCTATTATTTGAG
Sequence Type mRNA
Unitrap ID UNI27701

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 22053123..22053830 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029012 (Orc5l) NM_011959 origin recognition complex, subunit 5-like (S. cerevisiae) Gene [Source:MGI (curated);Acc:Orc5l-001]

 
Come back to gene ENSMUSG00000029012


For any suggestions or comments, please send an email to unitrap@crg.es