Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST52617
Clone ID OST52617
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST52617
Sequence
GGAGATGCTGGCCAGGGGTGCTTNATGACTGTGACCCTGAGCCTNTGTCACCACAGCGGNGGCGGAGGTGAGCGANCNNN
TGGGGAAGAGCCTCCTCAAGTTCTGCTCTGGAGATCTGGGGCCTGAGAGTATCCTGCCTGACACGCAGNTNCTGGACCCC
ATGCTTGCTGAGGCGCCCACCACACCCCTGGCACAAGCCCCANGCAAGGGCATGGATGATCGGGTGTTTTACATCTATAC
TTCTGGGACCACCGGGCTTCCTAAGGCTGCCATTGTGGNAGCACAGCAGGTACTACCACATTGNTGCCTTTGGCCACCAT
TCCTACAGNATGCGTGCCGCCGATGTGCTCTATAACTGCCTGCCACTCTACCACTCTNNANGGAAACATCNTNGGTNGGG
GGCAAGNGCGCCTNTNCGGGTAACGGNGTTTNTGCCCAAANAAGTTCTCCGCCACCC
Sequence Type mRNA
Unitrap ID UNI27702

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74103750..74104740 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031808 (Slc27a1) NM_011977 solute carrier family 27 (fatty acid transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:1347098]

 
Come back to gene ENSMUSG00000031808


For any suggestions or comments, please send an email to unitrap@crg.es