Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST52593
Clone ID OST52593
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST52593
Sequence
AGAACTGAGGCCTGACATCAGCGGTGCCCTGGAGCCCTCCAATATAGACACCAGTATCCTGGAGGAGTACATTGGCAAAG
AGGACGCCTCTGATCTCTGCTTCCCTGAGATCTCTGCACCAGCCAGCACTGCCTCCTTCCCCCACGGGCCACCGGCCATT
CCCGGCTCCAGCGGGCTCCACCATCTGAGCCCCCCTGGGAGCGGACCATCCCCTGGGCGCCATGGCCCCCTCCCACCCCC
GACCTACGGGACCCCACTCAACTGCAACAACAACAACGGCATGGGCACCGCCCCTAAGCCCTTCCTGGGGGGCTCTGGGC
CTCCCATCAAAGCAGAGCCAAAGGCCCCCTATGCCCCAGGNNCACTGGNAGACTNGNCCCCAGACTNAAGCTCTTAAGGG
CTANNCCCCTTNAAANGGGAAAGAAACCCCNATTTTTTAGGCACCATAGCCCCGGGGANTCTTTGCCACATGGGATTTT
Sequence Type mRNA
Unitrap ID UNI15384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10303143..10303599 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036098 (Gm98) gene model 98, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2684944]

 
Come back to gene ENSMUSG00000036098


For any suggestions or comments, please send an email to unitrap@crg.es