Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST52558
Clone ID OST52558
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST52558
Sequence
ACTGAGATCATAAGGCAAATGGGTTTTCTGCATCAAAAGACCCCGTCAAGAAGTCACANGTAATANGAGTTCCAAGAGGC
TATTTTGGCTTGTAAAACCCCAAAGAAGACTACCTCCTCCAGACTGGAGTGGAAGAAGGTGGGACAGGGGGTCTCCTTGG
TCTACTACCAACAGGCTCTNCAAGGTGACTTTAAAGACCGTGCTGAGATGATAGATTTCAATATACGAATCAAAAATGTT
ACAAGAAGTGATGCTGGAGAGTATCGCTGTGAAGTCAGCGCTCCGACTGAGCAAGGCCAGAACCTGCAGGAAGATAAAGT
CATGCTAGAAGTACTAGGGACNGCACACACATATGTAACGGATGCCAGCTGTCCCGTNCTNGTCCCCCAGCCCCGCGGAA
AGATTTTGGCTTTGTTTGGTTT
Sequence Type mRNA
Unitrap ID UNI10795

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84801813..84809826 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]

 
Come back to gene ENSMUSG00000053062


For any suggestions or comments, please send an email to unitrap@crg.es