Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST52395
Clone ID OST52395
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST52395
Sequence
GACTACAGTAGTGGTACATGTGGACTCCAAAGCTGAGCTCACTACCCTGCTGGAGCAGTGGGAAAAGGACCATGGCAGTG
GCCAGGATATGGTACCAATCCTTACCAGAATGTCTGAATTAATTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26784

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106731402..106733214 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040325 (Vprbp) NM_001015507 Vpr (HIV-1) binding protein Gene [Source:MGI Symbol;Acc:MGI:2445220]

 
Come back to gene ENSMUSG00000040325


For any suggestions or comments, please send an email to unitrap@crg.es