Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST52221
Clone ID OST52221
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST52221
Sequence
CTGAGCTTATGGCAAACCCCTGAAATGCTGGTGGAGATTGAAACAGCGTGGNCAGGCTTCTGGCTATTTGCTTGTTTGCT
TCTCTGCAGGATACTTTATCCACGACACAGTGGACATTGNGGTTAGCAAGCAAACTCGAGCTTCTTGGGAATACCTTGTT
CATCATGTCATGGNTATGGGCACCNNCTTCTCTGGNATCTTTNGGAAAANATTTGTTGGTGGTGGCNNCTTAACACTACT
GNTATAGGTCAGCAACATCTTCCTCACCTTAAGGATGATGATGAAGATAAACAATGCTCAGGATCTCCTCCTCTACAAGG
TCAACAAGTATATAAACTTGGTGCATGTACTTCCTCTTCCGATTGGCCCCTCAGGCCTTCCTCACCAAGGTCTTTCTACC
AGTAATGCTTGGCAA
Sequence Type mRNA
Unitrap ID UNI27709

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77993040..77993687 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019437 (Tlcd1) NM_026708 TLC domain containing 1 Gene [Source:MGI (curated);Acc:Tlcd1-001]

 
Come back to gene ENSMUSG00000019437


For any suggestions or comments, please send an email to unitrap@crg.es