Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST52162
Clone ID OST52162
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST52162
Sequence
CAGACTGAGGACAAAGCCCAGTTATGCCCCACCATCATTGACACCTTCCAAACCTGCTTTGTCAACAACGGCCCTTGAAG
AAAAA
Sequence Type mRNA
Unitrap ID UNI27711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 32953659..32953732 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019787 (Trdn) triadin Gene [Source:MGI Symbol;Acc:MGI:1924007]

 
Come back to gene ENSMUSG00000019787


For any suggestions or comments, please send an email to unitrap@crg.es