Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST52130
Clone ID OST52130
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST52130
Sequence
GTGCAGGATGAAAAGATGGCCCTNGCACTGCTGGTACCCCCGGGACCTGAGAGCTNCCGCCTTTTCACTCGAGAANNTCT
TGCTGCTATCGAAAAGCGTGCTGCANAAGAGAAAGCCANGAAACCCAAGAAAGAACAAGACATTGNCGATGAGAACAAGC
CAAAGCCAAACAGNGACTTGGAAGCTGGGAAGAACCTTCCATTTATCTATGGAGACATTCCTCCANAGATGGTGTCGGAG
CCTCTGGAGGACCTGGACCCCTACTACGTCAGTAAGAAAACTTTTG
Sequence Type mRNA
Unitrap ID UNI14371

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 65374470..65374748 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057182 (Scn3a) NP_061202 sodium channel, voltage-gated, type III, alpha Gene [Source:MGI (curated);Acc:Scn3a-001]

 
Come back to gene ENSMUSG00000057182


For any suggestions or comments, please send an email to unitrap@crg.es