Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XL909
Clone ID XL909
Vector pGT0Lxf
Project baygenomics

Sequence tag XL909
Sequence
AAAAGTTACAGAGAGATAACACAGACCCAGGACAACTGAAAGGTCTCTCGGCGTACACCCACATGGGGGTTCCATATTAC
TCCAAGTTGAGTGGGAGGGCTGCATACCTTGCCTCTTATAACCCAGCGAGAACTGATAAGAGGTTCTTCCTTAAGCGTCA
TGGGTTTATCAAAAAGGGGGGGGGGGTAAAGAAGCATGAGAAGACAAGCAATCATCTTCTTGGACCAAAGCCCTTTCCAC
TGGACAGATTATTAGCAATATTGTATAGTATAGTGGACAGCAGAGTGCGCGTCCGAACAGCAAATATCTTCTC
Sequence Type mRNA
Unitrap ID UNI7721

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 22022526..22030675 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029012 (Orc5l) NM_011959 origin recognition complex, subunit 5-like (S. cerevisiae) Gene [Source:MGI (curated);Acc:Orc5l-001]

 
Come back to gene ENSMUSG00000029012


For any suggestions or comments, please send an email to unitrap@crg.es