Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XL011
Clone ID XL011
Vector pGT0Lxf
Project baygenomics

Sequence tag XL011
Sequence
GTTTTTTATTACGGAAAAATGGCGCCTCCCAGTCCCCGGGAGCATCAGTCCGCGCCGGCGACCAGTGCGACCAAGCCTGA
CGCGGAGATGGTACTGCCTGGCTTCCCCGATGCAGACAGCTTCGTAA
Sequence Type mRNA
Unitrap ID UNI8892

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147932569..147932685 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017264 (Exosc10) NM_016699 exosome component 10 Gene [Source:MGI (curated);Acc:Exosc10-005]

 
Come back to gene ENSMUSG00000017264


For any suggestions or comments, please send an email to unitrap@crg.es