Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XL018
Clone ID XL018
Vector pGT0Lxf
Project baygenomics

Sequence tag XL018
Sequence
TTTTAAGAAGCCTCTACCTCCTACTGTGAAAAAGGAAGAGAGTCCTCCTCCACCTAAGGTGGTAAATCCACTGATTGGTC
TCCTGGGTGAATATGGAGGAGACAGTGACTATGAGGAAGAGGAAGAAGAGGAACAGGCTCCTCCTGTGCAGCCTCAGCCT
CAGCCTCGCGAGGAAATGACCAAGAAAGAGAATGAAGACGACAAACTCACTGACTGGAATAAACTGGCTTGTCTGCTCTG
CAGAAGGCAGTTTCCCAATAAAGAAGTTCTTACGAAACACCAACAACTGTCCGACCTGCACAAGCAAAACCTGGAAATTC
ACCGGAAGATAAAACAGTCAGAGCAAGAGCTCGCCTATCTGGAGAGGAGAGAGCGGG
Sequence Type mRNA
Unitrap ID UNI8886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107681907..107686072 238
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032582 (Rbm6) NM_029169 RNA binding motif protein 6 Gene [Source:MGI Symbol;Acc:MGI:1338037]

 
Come back to gene ENSMUSG00000032582


For any suggestions or comments, please send an email to unitrap@crg.es