Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST51353
Clone ID OST51353
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST51353
Sequence
AGACTGAGGAATTGATTTCAAGATCCGAACCGTGGACATATGAGGGGAAGAGGATCAAACTGCAAGTGTGGGACACGGCT
GGCCAANAACGATTCAAGACAATAACTACCGCCTATTACCGTGGAGCCATGGGCATTATCCTCGTATATGACATCACAGA
TGAGAAATCCTTCGAGAATATTCANAACTGGATGAAAAGCATCAAAGAGAATGCCTNTGCGGGAGTGGAGCGCCTCCTGC
TGGGAAACAAGTGTGACATGGAGGCCAAGCGGCAGGTGCAGAGAGAGCANGCGGAGAAGTTGGCTCGAGAGCACAGAATC
CNATTTTTTGAGACGAGTGCCAAATCCAGTGTGAATGTGGATGANGCTTTCAATTCCCTGGCCCGNGACATCTTGCTTAA
AGACAGGAGGCCGGAGATCGGGAACCCACAA
Sequence Type mRNA
Unitrap ID UNI22131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90026157..90028824 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027935 (Rab13) NM_026677 RAB13, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab13-002]

 
Come back to gene ENSMUSG00000027935


For any suggestions or comments, please send an email to unitrap@crg.es