Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST51352
Clone ID OST51352
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST51352
Sequence
GACTGAGGCTGCCCTTGGGGCCCTGGGCAAGGCCTTGAACCCCTTGGAGGACTGGCTGCGGCTGCACACCTACCTGGCTG
GAGATGCCCCCACTCTGGCTGACTTAGCTGCTGTGACAGCCTTACTGCTGCCTTTCCGATACGTTCTGGACCCTTCTGCC
CGCCGGATCTGGGGCAATGTGACTCGCTGGTTTAACACTTGTGTCCGGCAACCGGAATTCCGGGCTGTGCTGGGAGAAGT
GGCCCTGTACTCGGGGGCCAGGTCTGTCACTCAACAGCCAGGCTCTGAGGTCATCGCACCCCAAAAAACACCCGCGCAGC
TCAAAAAAGAGGCAAAGAAACGGGAGAAACTANGAGAAATTCCAGAAGATGCTGTGGACCCCCATTCCAACCCTNAACCC
CCAATGTTTCATCAACAGGGGATGGGAGCATAAAAATATTTTTCCCAACAAAACA
Sequence Type mRNA
Unitrap ID UNI20174

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35141148..35141815 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007029 (Vars) NM_011690 valyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:90675]

 
Come back to gene ENSMUSG00000007029


For any suggestions or comments, please send an email to unitrap@crg.es