Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST51034
Clone ID OST51034
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST51034
Sequence
CAAAGTCAGATGGATGCATATACTTNTGATGAACAAGAAAGTTTGGAAGTTGCCATCCAGTGTTTGGAGACCGTTTTTAA
GATCAGTCCAGAAGACACACATCTGGCAGTTTCACAGCCTTTGACAGAAATGTTCACAAACTCCGTCTGTAAGAATGACA
TACGGCCGCTTTCAAACTCAGTGCCCGAGGATGTGGGAAAGGCGGACCAGCTGAAGGATGAAGG
Sequence Type mRNA
Unitrap ID UNI27737

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 104908402..104911617 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042743 (Sgtb) NM_144838 small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta Gene [Source:MGI Symbol;Acc:MGI:2444615]

 
Come back to gene ENSMUSG00000042743


For any suggestions or comments, please send an email to unitrap@crg.es