Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST51016
Clone ID OST51016
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST51016
Sequence
GACTGAGATTGTTACCTGAACTAAATTCCTTGACGTTGGCGGAGAAAGATAATTTTCTTTCCAGTCATCAAACAGCTAGC
ACTGAACCACTGGATAACATANGAACTANTCCTCAAGCCGAGCGTGGTGGCGCAGGCCTTTAATNCCACCACTTGGNAGG
CNGAGGCNGGTGA
Sequence Type mRNA
Unitrap ID UNI26282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 76875202..76887129 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046942 (2410003J06Rik) NP_082301 melanoma antigen family B, 16 Gene [Source:MGI Symbol;Acc:MGI:3644898]

 
Come back to gene ENSMUSG00000046942


For any suggestions or comments, please send an email to unitrap@crg.es