Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST50553
Clone ID OST50553
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST50553
Sequence
TGACCTATGAGGATGTGCATGTGAACTTCTCTCGGGAAGAGTGGGCTTTGCTGGATCCTTCTCAGAAGAGTCTCTACAAG
GATGTGATGCTGGAAACCTACTGGAACCTGACTTGTATAGGCTACATGTGGGAAGACTGCAATATTGAGGATCATTGTCA
AAGTTCTAGAAGACATGGAAGGTGTATCAACTGTCCCTCTGCATATGGAAAGAAGCAGTGTACCAATCTCTTTCCTANAA
CAATTANAAGAAGATATGTAGTCACCCCCTTTGTGAGAAGAGGAGGTGAATGTGATACAAGTTTACAAGTACTTGGTTTT
CCAGTTTCAGTGGGAATACATCAAAATACTGACCGTGNAGAAAAGCCCTTTGTGGACAAGGGAA
Sequence Type mRNA
Unitrap ID UNI27748

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56035251..56036781 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003198 (BC011426) NM_145490 cDNA sequence BC011426MCG20929, isoform CRA_b ; [Source:UniProtKB/TrEMBL;Acc:Q91VM8]

 
Come back to gene ENSMUSG00000003198


For any suggestions or comments, please send an email to unitrap@crg.es