Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST50517
Clone ID OST50517
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST50517
Sequence
GAACTGAGCTCTCCTACTCCGAAGCCGGGTGGNCATGACCCGCTTATGTGTCAGCATTTCTCCAGGACCATGCCTACCCA
AGGACGGTGTGGNACCCAGCACATTCACCTGTCACCAAGCCACCACTCTGGTTCCAAGGCTGCATCTCTCCACTGGACCA
GTGAGAGGGTTGTCAGTGTTCTGCTCTTGGGGCTGATCCCTGCTGGGTACTTGAATCCCTGCTCTGTGGNGGACTACTCT
NTGGNTGNAGCCCTCACCCTGCACAGTCACTGGGGCCTTGGACAAGTGGTTACCAGACTACGTTCATGGGGACACCCTGC
CGAAGGCTGCCAGGGCAGGCCTCTTGGCACTCTCAGCTTTGACCTTTGCTGGGCTTTGCTACTTCAATTACCA
Sequence Type mRNA
Unitrap ID UNI27750

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 50405236..50408774 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000171 (Sdhd) NM_025848 succinate dehydrogenase complex, subunit D, integral membrane protein Gene [Source:MGI Symbol;Acc:MGI:1914175]

 
Come back to gene ENSMUSG00000000171


For any suggestions or comments, please send an email to unitrap@crg.es