Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST50440
Clone ID OST50440
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST50440
Sequence
GAGTGAGAAAATGGTGAAAGCCACAGCCAACAGGAACCAAGCACGATGGTGCAGGAACGGCCCATGTTTCTGCAGGGAAG
GTTCTGGGCTCTGTGGAGTTCTCCCTGCCGCCCAGCCAACCCCTGCCTGCCGGAACCTCGCCCATCCACACTAGCCTGCT
TGACATGAGGAGGAACGTGGCTGAACTCAAGCTCNAACTCCAGCAGATGAGGCAGCTCCAGCTGCAGAACCAGGAGATTC
TGAGGGCGATGATGAAGAAGGCTGAGCTGGAAATCAGTAACAAAGTGAAGGAGACCATGAAGAGACTAGAGGATCCGGTA
CAGCGTCAGCGCACCCTGGTGGAGCAAGAGAGACAGAAGTACCTCCACGAAGAANAGCGGATTGTCAAAAAGTTATGTGA
GCTGGAGGACTTT
Sequence Type mRNA
Unitrap ID UNI27753

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20681840..20702584 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es