Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XL078
Clone ID XL078
Vector pGT0Lxf
Project baygenomics

Sequence tag XL078
Sequence
GCGCAACCACGAGACGGCCTTCCAGGGCATGCTCCGGAAACTGGACATTAAAAACGAAGGCGATGTTAAATCTTTTTCTC
GAGTAATGGTCCATGTTTTCAAAGATGGCGTAACAACCTGGGGCAGGAATGTGACTCTTATTTCTTTCGGTGCCTTTGTG
GCCAAACACTTAAAGAGCGTAAACCAAGAAAGCTTCATCGAACCATTAGCAGAAACTATCACAGATGTTCTTGTAAGGAC
GAAACGGGACTGGCTTGTCAAACAAAGAGGCTG
Sequence Type mRNA
Unitrap ID UNI531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95463385..95463930 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038612 (Mcl1) NP_032588 myeloid cell leukemia sequence 1 Gene [Source:MGI Symbol;Acc:MGI:101769]

 
Come back to gene ENSMUSG00000038612


For any suggestions or comments, please send an email to unitrap@crg.es